Sequence of the rabbit β-casein cDNA: comparison with other casein cDNA sequences
نویسندگان
چکیده
منابع مشابه
Nucleotide sequence of a cDNA encoding mouse beta casein.
Beta casein 1s a major «1 Ik protein produced by the lactating mammary gland and I t s gene expression 1s hormonally controlled ( 1 ) . cDKAs encoding mouse beta casein wore Isolated from a muse maoaary gland l ibrary prepared as described ( 2 ) , using a short cONA clona of mouse beta casein (1) as a hybridization probe. The longest cDNA clone was chossn and the DNA sequence of each strand was...
متن کاملThe chaperone ability comparison of norma II-casein and modified d-casein upon interaction with lysozinie
Diminishing protein aggregation by chaperone is very important factor in medicine and industry. In this paper, itis induced the chaperone ability for 0-casein upon modification of its acidic residues by Woodward reagentK(WRK) and examined on lysozyme as a target protein at pH 7.2 and outlined the mechanism for chaperoneability of modified system by UV-Vis and fluorescence spectroscopy and theor...
متن کاملRapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.
Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...
متن کاملExploring the Interaction Mechanism of Coumarin with Bovine β-Casein: Spectrofluorometric and Molecular Modeling Studies
This paper is designed to examine the binding behavior of Coumarin with bovine -casein (βCN) through fluorescence spectroscopy and molecular modeling techniques. The data analysis on fluorescence titration experiments at various temperatures represents the enthalpy driven nature for the formation of Coumarin–βCN complex and the prevailed role of hydrogen bonds and van der Waals interactions in...
متن کاملcDNA sequence of rabbit tissue factor pathway inhibitor.
The authors note the following errors in the reported cDNA sequence of rabbit tissue factor pathway inhibitor, TFPI These changes increase sequence identity with human TFPI at both the cDNA and amino acid level, but do not otherwise alter the conclusions presented in the original report.
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Nucleic Acids Research
سال: 1988
ISSN: 0305-1048,1362-4962
DOI: 10.1093/nar/16.24.11814